Introduction
Materials and methods
Plant material
DNA extraction and Illumina sequencing
Microsatellite design and analysis
Primers ID | Msat motif | Primer sequences | Expected length (bp) | Length (bp) | Ta(°C) | PCR Cycles |
---|---|---|---|---|---|---|
Opat_11 | (ACT)13 | (FAM) GGTGAAATGAGTCGGAAGTC | 221 | 81–239 | 55 | 30 |
ACCGCACTGCAAATAAATCC | ||||||
Opat_13 | (CCG)9 | (JOE) GAACCGTACCGAGTGAGAC | 150 | 133–147 | 55 | 30 |
CTGAGCTATGAACCAGTCCC | ||||||
Opat_14 | (ACAT)10 | (JOE) GGGTAGGGCAGCTATAAAGG | 235 | 209–239 | 55 | 35 |
AGAGAAGGTGGAAGAAGGTG | ||||||
Opat_20 | (AC)17 | (FAM) CTAACGCGGTCCAATTCTTC | 112 | 91–116 | 59 | 30 |
GGTACTATCGGGTTGGCC | ||||||
Opat_27 | (CT)14 | (FAM) GTTCACAACATTGCGAGAGG | 173 | 129–183 | 60–0.2 | 30 |
TCTTGGGAGGTTACAGCTTC | ||||||
Opat_29 | (CTT)11 | (JOE) ATGGTTCCTCTGGTTCTTCG | 130 | 110–139 | 53 | 25 |
CAATAGCCTTCTTTGCCGTC | ||||||
Opat_30 | (AG)13 | (FAM) TGTCACCACGGAACAGTTAC | 173 | 152–218 | 53 | 30 |
CTCTCCAAACTCCTCCAACC | ||||||
Opat_32 | (CT)20 | (FAM) CCATCACATTGACTGCATCTG | 197 | 168–204 | 53 | 25 |
GAATTCACGTCTCTGGGCA | ||||||
Opat_34 | (CT)14 | (FAM) AGGCAGGTCTGATTCGATATG | 174 | 153–193 | 52 | 30 |
GAACACGACATTGCCCAGA | ||||||
Opat_36 | (CT)8 | (JOE) TATCCACTGCTCGCTATGTG | 134 | 127–177 | 53 | 30 |
CACATCAGCTTCGATGGAGA | ||||||
Opat_38 | (CT)10 | (JOE) TGCAACAACCACTTTCTCAC | 115 | 101–103 | 53 | 25 |
CTAGCACAAGGATGCTGAGT | ||||||
Opat_39 | (GA)15 | (FAM) GGAAGTTAGTCCCTCCGAAC | 147 | 138–236 | 53 | 30 |
CTCCAAGTCAATTTCGCATCT |
Genetic diversity and structure
Results
Microsatellite design and analysis
Loci ID (populations) | N | Num | Eff_num | HO | HS | GIS | Peaks |
---|---|---|---|---|---|---|---|
Italy | 45 | ||||||
Opat_11 | 9 | 3.978 | 0.859 | 0.754 | − 0.139 | 4 | |
Opat_13 | 3 | 2.118 | 0.683 | 0.532 | − 0.285 | 3 | |
Opat_14 | 5 | 3.354 | 0.852 | 0.707 | − 0.205 | 4 | |
Opat_20 | 4 | 1.571 | 0.280 | 0.371 | 0.246 | 2 | |
Opat_27 | 6 | 2.319 | 0.689 | 0.573 | − 0.201 | 4 | |
Opat_29 | 5 | 2.123 | 0.313 | 0.540 | 0.421 | 3 | |
Opat_30 | 6 | 4.601 | 0.893 | 0.788 | − 0.132 | 4 | |
Opat_32 | 9 | 5.488 | 0.854 | 0.824 | − 0.036 | 4 | |
Opat_34 | 8 | 4.051 | 0.837 | 0.759 | − 0.103 | 3 | |
Opat_36 | 6 | 2.234 | 0.526 | 0.559 | 0.059 | 3 | |
Opat_38* | 1 | 1.000 | 0.000 | 0.000 | – | 1 | |
Opat_39* | 8 | 2.896 | 0.820 | 0.659 | − 0.245 | 3 | |
Mean (excluding monomorphic) | 6.273 | 3.157 | 0.691 | 0.642 | − 0.056 | ||
Algeria | 20 | ||||||
Opat_11 | 11 | 4.418 | 0.900 | 0.786 | − 0.145 | 3 | |
Opat_13 | 5 | 2.463 | 0.721 | 0.605 | − 0.192 | 3 | |
Opat_14 | 7 | 3.527 | 0.842 | 0.728 | − 0.156 | 3 | |
Opat_20 | 6 | 3.867 | 0.258 | 0.788 | 0.672 | 2 | |
Opat_27 | 5 | 1.317 | 0.213 | 0.251 | 0.154 | 4 | |
Opat_29 | 7 | 4.449 | 0.463 | 0.809 | 0.428 | 2 | |
Opat_30 | 10 | 5.758 | 0.792 | 0.844 | 0.062 | 4 | |
Opat_32 | 10 | 4.894 | 0.925 | 0.808 | − 0.145 | 3 | |
Opat_34 | 11 | 6.617 | 0.771 | 0.869 | 0.113 | 4 | |
Opat_36 | 3 | 1.311 | 0.162 | 0.251 | 0.352 | 2 | |
Opat_38* | 2 | 1.487 | 0.000 | 0.364 | 1.000 | 1 | |
Opat_39* | 9 | 4.090 | 0.875 | 0.768 | − 0.140 | 3 | |
Mean | 7.167 | 3.683 | 0.577 | 0.656 | 0.121 | ||
Canary Islands | 29 | ||||||
Opat_11 | 5 | 2.995 | 0.848 | 0.673 | − 0.260 | 3 | |
Opat_13 | 2 | 1.075 | 0.066 | 0.073 | 0.090 | 2 | |
Opat_14 | 4 | 2.145 | 0.718 | 0.540 | − 0.331 | 3 | |
Opat_20 | 13 | 6.497 | 0.480 | 0.872 | 0.450 | 2 | |
Opat_27 | 15 | 10.416 | 0.621 | 0.925 | 0.329 | 4 | |
Opat_29 | 8 | 3.487 | 0.422 | 0.736 | 0.426 | 2 | |
Opat_30 | 22 | 4.984 | 0.937 | 0.808 | − 0.160 | 3 | |
Opat_32 | 8 | 5.098 | 0.330 | 0.835 | 0.604 | 2 | |
Opat_34 | 11 | 6.055 | 0.491 | 0.859 | 0.428 | 2 | |
Opat_36 | 2 | 1.231 | 0.000 | 0.201 | 1.000 | 1 | |
Opat_39* | 1 | 1.000 | 0.000 | 0.000 | – | 1 | |
Mean (excluding monomorphic) | 9 | 4.398 | 0.491 | 0.716 | 0.257 |
Species | Opat markers | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
11 | 13 | 14 | 20 | 27 | 29 | 30 | 32 | 34 | 36 | 38 | 39 | |
O. patens (Italy) | X | X | X | X | X | X | X | X | X | X | O | X |
O. patens (Algeria) | X | X | X | X | X | X | X | X | X | X | X | X |
O. canariensis | X | X | X | X | X | X | X | X | X | X | - | O |
O. provincialis | O | O | X | X | - | O | O | - | - | - | - | X |
O. mascula | X | X | X | NA | NA | X | O | X | NA | X | NA | O |
O. mascula subsp. ichnusae | X | X | X | NA | NA | X | O | X | NA | X | NA | O |
O. spitzelii | NA | NA | NA | NA | NA | NA | NA | X | NA | X | NA | X |
O. × fallax | X | O | X | X | X | X | X | X | X | X | O | X |
Genetic diversity and structure
Locality | Sample Size | Num | Eff_num | HO | HS | GIS | Selfing Rate (SE)* |
---|---|---|---|---|---|---|---|
Portofino (Italy) | 12 | 5.1 | 3.085 | 0.653 | 0.622 | -0.049 | 0.072 (0.159) |
Breccanecca (Italy) | 11 | 4.4 | 3.196 | 0.706 | 0.648 | -0.09 | 0 |
Romaggi (Italy) | 16 | 4.6 | 2.942 | 0.675 | 0.639 | -0.056 | 0.098 (0.139) |
Capreno (Italy) | 6 | 4.3 | 2.990 | 0.689 | 0.666 | -0.035 | 0 (0.157) |
Bejaia (Algeria) | 10 | 6 | 3.497 | 0.653 | 0.69 | 0.054 | 0.288 (0.187) |
Souk-Ahras (Algeria) | 10 | 5.1 | 3.149 | 0.557 | 0.634 | 0.122 | 0.035 (0.238) |
Tenerife (Canary Islands) | 10 | 2.8 | 2.070 | 0.44 | 0.439 | -0.003 | 0 (0.367) |
Gran Canaria (Canary Islands) | 10 | 4.7 | 2.921 | 0.503 | 0.62 | 0.188 | 0 |
La Gomera (Canary Islands) | 9 | 6.8 | 3.893 | 0.535 | 0.66 | 0.189 | 0.160 (0.223) |
Groups | Source of Variation | % Vari | F-stat | F-value |
---|---|---|---|---|
OP AL CI | Within locality Among localities within group Among groups | 0.468 0.119 0.413 | Rho_st Rho_sc Rho_ct | 0.532 0.203*** 0.413*** |
OP-AL CI | Within locality Among localities within group Among groups | 0.415 0.163 0.421 | Rho_st Rho_sc Rho_ct | 0.585 0.282*** 0.421*** |
AL-CI OP | Within locality Among localities within group Among groups | 0.477 0.288 0.235 | Rho_st Rho_sc Rho_ct | 0.523 0.376*** 0.235 |
OP-CI AL | Within locality Among localities within group Among groups | 0.482 0.357 0.162 | Rho_st Rho_sc Rho_ct | 0.518 0.425*** 0.162 |
Source of variation | SSD | d.f | MS | Variance components | %Var | F-stat | F-value |
---|---|---|---|---|---|---|---|
Within population | 73.023 | 41 | 1.781 | 1.781 | 0.898 | – | – |
Among population | 11.926 | 3 | 3.975 | 0.202 | 0.102 | Rho_st | 0.102*** |
Discussion
Genetic structure and taxonomic delimitation
Influence of polyploidy on current genetic diversity patterns
Conclusions and implications for conservation
-
Orchis canariensis should be assessed for the IUCN red list;
-
the Mediterranean assessment of O. patens (Calevo et al. 2018) should be revised taking into account the taxonomic delimitation suggested here (which will probably lead to a higher category of threat), the evidence of restricted gene flow, narrow range and low number of individuals (Orsenigo et al. 2016);
-
given that the availability of the main symbiotic fungus of O. patens s.l. at global scale seems not to be a limiting factor for their distribution (Calevo et al. 2020), conservation actions aimed at preventing further habitat fragmentation should be taken. In particular, local authorities and agencies in Algeria, Tunisia (where the natural population is already potentially extinct), Italy and the Canary Islands should institute measures to protect remaining individuals from damage and illicit collection.
-
Further non-destructive sampling, even if difficult due to the rarity and low density of the species, may be required to better investigate the level of inbreeding and its contribution to the reproduction of the populations. Once reproduction mechanisms are clarified, strategies which facilitate pollination should be taken into account, also considering the low fruit-set of the species.